stanford-data.should_get 354 Bytes
Newer Older
1
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -b data  ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1
2 3

$ Number of reads
4
e1:"total": [13153]
5 6

$ Number of segmented reads
7
e1:"segmented": [13139]
8 9

$ Most abundant window
10
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]