stanford-data.should_get 346 Bytes
Newer Older
1
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -d -b data  ../../data/Stanford_S22.fasta ; cat out/data.vidjil | sh format-json.sh
2 3

$ Number of reads
4
1:"total" : [ 13153 ] ,
5 6

$ Number of segmented reads
7
1:"segmented" :  [ 13139 ] 
8 9

$ Most abundant window
10
1:"id" : "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "reads" : [ 8 ]