cluster-epsilon.should 1.34 KB
Newer Older
1
!LAUNCH: $VIDJIL_DIR/$EXEC -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 1 -r 1 $VIDJIL_DATA/clones_simul.fa
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

$ Junction extractions
1:found 25 windows in 66 reads

$ No clustering
1:==> 25 clones

$ Clone 1 output
1:Clone #001 .* 29 reads

$ Clone 2 output
1:Clone #002 .* 14 reads

$ Clone 3 output (sequencing error)
1:Clone #003 .* 1 reads


19
!LAUNCH: $VIDJIL_DIR/$EXEC -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 --cluster-epsilon 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
Mikaël Salson's avatar
Mikaël Salson committed
20

Mathieu Giraud's avatar
Mathieu Giraud committed
21
$ Window extractions
Mathieu Giraud's avatar
Mathieu Giraud committed
22
1:windows up to 50bp
Mathieu Giraud's avatar
Mathieu Giraud committed
23
2:found 25 windows in 66 reads
Mikaël Salson's avatar
Mikaël Salson committed
24 25

$ Some clustering
26
1:==> 2 clusters
Mikaël Salson's avatar
Mikaël Salson committed
27

28 29 30
$ Clones #01 and #02 are clustered (not together): their windows appear two times in .vidjil ('id' and 'clusters')
2:"CTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGC"
2:"GCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTA"
Mikaël Salson's avatar
Mikaël Salson committed
31

32 33
$ Some other clone is not clustered: its windows appear only once .vidjil ('id')
1:"TGCGATAGCGATCCCGCGGTATTACTATGATACTAGTGGCCCAAACGACT"
Mikaël Salson's avatar
Mikaël Salson committed
34

35
$ Clones #01, #02 and other have the start of their sequence in .vidjil, on the good strand
Mathieu Giraud's avatar
Mathieu Giraud committed
36 37
1: "sequence": "ACGCTGGCAATGGTAACACAAAATATTCACAGAAG
1: "sequence": "TAGTGGTGCCATATACTACGCAGACTCTGTGAAGG
38
1: "sequence": "TATACTACGCAGACTCTGTGAAGGGCCGATTCACC