trd-dd2-dd3.fa 1.35 KB
Newer Older
1
>TRDV2*01_0//0_TRDJ1*01  [TRD]
2 3 4
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa

5

6
# without DD2 upstream, the recombination can not be detected, 'TODO' is expected here
7
>TRDD2*01_0//0_TRDJ1*01  [TRD+]  TODO
8 9 10
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa

11 12 13 14 15 16
# same sequence, with some DD2 upstream
>TRDD2*01_0//0_TRDJ1*01  [TRD+]
TGTGccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa

# same sequence, with more DD2 upstream
17 18 19 20 21
>TRDD2*01_0//0_TRDJ1*01  [TRD+]
TGTGTTTCATTGTGccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa


22
# without DD2 upstream, the recombination can not be detected, 'TODO' is expected here
23
>TRDD2*01_0//0_TRDD3*01  [TRD+]  TODO
24 25 26
ccttcctac
actgggggatacg

27 28 29 30 31 32
# same sequence, with some DD2 upstream
>TRDD2*01_0//0_TRDD3*01  [TRD+]
GTGccttcctac
actgggggatacg

# same sequence, with more DD2 upstream and DD3 downstream
33 34 35 36 37
>TRDD2*01_0//0_TRDD3*01  [TRD+]
TGTGTTTCATTGTGccttcctac
actgggggatacgCACAGTGCTA


38
>TRDV3*01_0//0_TRDD3*01  [TRD+] BUG-LOCUS
39 40 41
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg

42 43 44 45 46 47
# same sequence, with DD3 downstream
>TRDV3*01_0//0_TRDD3*01  [TRD+]
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacgCACAGTGCTA


48
>TRDV3*01_0//0_TRDJ4*01  [TRD]
49 50
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
ccagacccctgatctttggcaaaggaacctatctggaggtacaacaac