segmentation.fasta 1.09 KB
Newer Older
Mathieu Giraud's avatar
Mathieu Giraud committed
1 2 3 4 5 6 7 8 9 10 11 12
>seq-seg+
tgtgccacctgggacaggGAATTATTATAAGAAACT
>seq-seg-
AGTTTCTTATAATAATTCcctgtcccaggtggcaca
>seq-short
ATTA
>seq-strand
tgtgccacctgggacaggAGTTTCTTATAATAATTC
>seq-zero
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>seq-fewV
AAAAAAAAAAAAAAAAAAGAATTATTATAAGAAACT
13 14
>seq-fewV-rc
AGTTTCTTATAATAATTCTTTTTTTTTTTTTTTTTT
15 16
>seq-fewV2
AAAAAAAAAAAAAAAAAAGAATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTGGTTGTCAC
Mathieu Giraud's avatar
Mathieu Giraud committed
17
>seq-fewJ
18 19 20
tgtgccacctgggacaggAAAAAAAAAAAAAAAAA
>seq-fewJ-rc
TTTTTTTTTTTTTTTTTcctgtcccaggtggcaca
21 22
>seq-fewJ2
tgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacaggAAAAAAAAAAAAAAAAAA
23 24

>seq-ambiguous-VJVJ
Mathieu Giraud's avatar
Mathieu Giraud committed
25
tgtgccacctgggacaggGAATTATTATAAGAAACTtgtgccacctgggacaggGAATTATTATAAGAAACT
26

27
>seq-delta-min
28 29 30
#vvvvvvvvvvvvvvvvvv               # TRGV11*01 (start)
#         jjjjjjjjjjjjjjjjjjjjjjj # TRGJ1*02
#VVVVVVVVVJJJJJJJJJJJJJJ          # contiguous 10-mer
31
cttgggcagttggaacaacACTTGTTGTCACAG
32

33 34 35 36 37 38
>seq-delta-min-padded
# seq-delta-min padded with some V and some J
tcttccaacttggaagggagaacgaagtcagtcaccaggctgactgggtcatctgctgaa
cttgggcagttggaacaacACTTGTTGTCACAG
gaattattataagaaactctttggcagtggaacaacactggttgtcac

Mathieu Giraud's avatar
Mathieu Giraud committed
39
>seq-seg-no-window
40
ctgggacaggGAATTATTATA