labels-grep-reads.should 576 Bytes
Newer Older
Mathieu Giraud's avatar
Mathieu Giraud committed
1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --out-reads --label-filter --label GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
2

Mathieu Giraud's avatar
Mathieu Giraud committed
3 4
# See also combo-grep-reads.should-get

Mathieu Giraud's avatar
Mathieu Giraud committed
5 6
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
7 8 9 10

$ Tbere are the three IGHV/D/J genes in out/seq/clone.fa-1
3:>IGH

Mathieu Giraud's avatar
Mathieu Giraud committed
11 12
$ There are 2 reads in out/seq/clone.fa-1
2:>lcl