Mise à jour terminée. Pour connaître les apports de la version 13.8.4 par rapport à notre ancienne version vous pouvez lire les "Release Notes" suivantes :
https://about.gitlab.com/releases/2021/02/11/security-release-gitlab-13-8-4-released/
https://about.gitlab.com/releases/2021/02/05/gitlab-13-8-3-released/

algo-then-fuse.should 717 Bytes
Newer Older
1
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
2
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
3 4

$ Points list
5
1:"original_names": \[".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"\]
6 7

$ Most abundant window, twice, fused 
8
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8, 8\].*"top": 2
9

10
$ Windows that are not in the bottom of the distribution
11
1: "distribution": \{[^}]+ "0.00001": \[9062, 9062\]