segmentation-2.fa 1.09 KB
Newer Older
1 2
# Testing unsegmentation classification

3 4
# Sequences outside any V(D)J locus

5
>too_few_vj-1
6 7
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGAGAAGAAC

8
>too_few_vj-2
9 10
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG

11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
>too_few_vj-3
CACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGT


# Fake sequences

>too_short
acgt

>strand IGKV1-12*01(revcomp)--IGKJ1*01
ggagggaaactgttagcctgttgacaatagtaagttgc
gtggacgttcggccaagggaccaaggtggaaatcaaac

>only_V TRDV1*01--nothing
ttacagctagaagattcagcaaagtacttttgtgctcttggggaact
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACCTAGGCATGGCTC

>only_J nothing--TRGJ1*01
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACCTAGGCATGGCTC
gaattattataagaaactctttggcagtggaacaacactggttgtcacag

>ambiguous TRGV1*01 TRGJ1*01 TRGV1*01 TRGJ1*01
ggaatcactccaggaaagtatgacactggaagcacaaggagcaattggaatttgaga
gaattattataagaaactctttggc
ctgcaaaatctaattaaaaatgattctgggttctattactgtgccacctgggacagg
agtggaacaacactggttgtcacag

>too_short_w TRGV1*01 TRGJ1*01
actgtgccacctgggacagg
gaattattataagaaactct