segment_S22.should-get 2.41 KB
Newer Older
1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -c segment $VIDJIL_DIR/data/segment_S22.fa | grep '^>'
Mikaël Salson's avatar
Mikaël Salson committed
2
3
4
5
6
7
8
9
10
11
12
13
14
15

$ First sequence Stanford
#                            164        175                 195     203
#                             |          |                   |       |
# S22  : 147 tgtattactgtgcgagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccaggga
#            ||||||||||||||||||                                      |||||||||||||| |||
# V3-48: 277 tgtattactgtgcgagaga         |||||||||||||| |||||| 
# D3-22:   0                             gtattactatgatagtagtggttattactac
# J4   :   0                                                 actactttgactactggggccaaggaa
# V: 1 del
# N1: CGATCCCCCG
# D: 0 del (left), 10 del (right)
# N2: CCCAAAC
# J: 8 del
16
1:>lcl\\|FLN1FA002RWEZA.1\\|.*VDJ 1 165 176 196 204 243 IGHV3-48.0. 1/CGATCCCCCG/0 IGHD3-22.0. 10/CCCAAAC/8 IGHJ4.0.
Mikaël Salson's avatar
Mikaël Salson committed
17
18
19
20
21
22
23
24
25
26
27
28
29
30

$ Second sequence Stanford
#                           165 169        180
#                            |   |          | 
# S22   : 150 tattactgtgcgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
#             ||||||||||||||||                ||||||||||||| |||||||||||||||||||||||||||||||| ||||
# V1-3  : 279 tattactgtgcgagaga  ||||||||||||
# D6-13 :   0             gggtatagcagcagctggtac
# J3*02 :                                     tgatgcttttgat-atctggggccaagggacaatggtcaccgtctcttcag
# V: 1 del
# N1: TGG
# D: 7 del, 2 del
# N2: C
# J: 0 del
31
1:>lcl\\|FLN1FA001BLION.1\\|.*VDJ 1 166 170 181 183 233 IGHV1-3.01 1/TGG/7 IGHD6-13.0. 2/C/0 IGHJ3.0.
Mikaël Salson's avatar
Mikaël Salson committed
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46

$ Third sequence Stanford
#                                 169     177                            208   214  
#                                  |       |                              |     |
# S22   : 148 ttgtattactgtgcaaaagataaaattgggtattatgattacgtttgggggagttatcgtttgggtctactggggccagggaaccctggtcaccgtctcctcag
#             ||||||||||||||||||||||                                            ||||||||||||||||||||||||||||||||||||||
# V3-9  : 276 ttgtattactgtgcaaaagata       ||||||||||||||||||||||||||||||||
# D3-16*02: 0                              gtattatgattacgtttgggggagttatcgttatacc
# J4*02 :   0                                                         actactttgactactggggccagggaaccctggtcaccgtctcctcag
#
# V: 0 del
# N1: AAATTGG
# D : 0 del, 5 del
# N2 : TGGGT
# J : 10 del
47
1:>lcl\\|FLN1FA002SGU3N.1\\|.*VDJ 1 170 178 209 215 252 IGHV3-9.0. 0/AAATTGG/0 IGHD3-16.0. 5/TGGGT/10 IGHJ4.0.