segmentation-D-read-number.should-get 1.65 KB
Newer Older
1
2
3
4
5
6
7
8
9
10

# We launch three times a sequence of interest (buggy-D.fa) with a various
# number of distinct reads (mutations randomly inserted in the middle).

# The segmentation of one sequence should not depend on the number of the
# other reads. This is what is tested, we first put 10 sequences, then 5 and
# finally just the sequence of interest alone.

!LAUNCH: (file1=$(mktemp); \
(for i in {1..10}; do \
11
  echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | LC_CTYPE=C tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
12
13
14
15
16
done;\
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file1; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file1; \
file2=$(mktemp); \
(for i in {1..5}; do \
17
  echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | LC_CTYPE=C tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
18
19
20
done;\
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file2; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file2;\
Mathieu Giraud's avatar
Mathieu Giraud committed
21
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/buggy-D.fa)
22
23

$ Three times the same window
Mathieu Giraud's avatar
Mathieu Giraud committed
24
3: TGTGCGGGATCTTCGTCCTCTTATCATAATAATGGTTTTTTGGCGGGGGAGTCATGGGGC
25
26

$ Three times the same segmentation
Mathieu Giraud's avatar
Mathieu Giraud committed
27
3: IGHV4-34.*IGHD.*IGHJ4